![]() Available for Licensing Call 1.617.283.2182 or Email Visit the MVS Solutions Technology Marketplace for Additional Licensing Opportunities |
|||||||
Transcriptional Coactivator ASC-2 The present application describes a transgenic mouse whose genome comprises a DNA sequence unit encoding a fragment of Activating Signal Cointegrator-2 (ASC-2) comprising a C-terminal LXXLL motif polypeptide but not N-terminal LXXLL motif polypeptide, wherein Liver X Receptor (LXR) trans activating activity is inhibited, and uses therefor. What is claimed is: 1. 1. A transgenic mouse whose genome comprises a DNA sequence unit encoding a fragment of Activating Signal Cointegrator-2 (ASC-2) comprising a C- terminal LXXLL motif polypeptide but not N-terminal LXXLL motif polypeptide, wherein Liver X Receptor (LXR) trans activating activity is inhibited. 2. The transgenic mouse of claim 1, wherein the C-terminal LXXLL motif polypeptide is second C-terminal LXXLL motif polypeptide. 3. The transgenic mouse of claim 1, wherein the C-terminal LXXLL motif polypeptide is about 100 amino acids. 4. The transgenic mouse of claim 3, wherein the C-terminal LXXLL motif polypeptide is about 80 amino acids. 5. The transgenic mouse of claim 4, wherein the C-terminal LXXLL motif polypeptide is about 60 amino acids. 6. The transgenic mouse of claim 5, wherein the C-terminal LXXLL motif polypeptide is about 50 amino acids. 7. The transgenic mouse of claim 6, wherein the C-terminal LXXLL motif polypeptide is about 30 amino acids. 8. The transgenic mouse of claim 7, wherein the C-terminal LXXLL motif polypeptide is about 10 amino acids. 9. The transgenic mouse of claim 2, wherein the C-terminal LXXLL motif polypeptide is about 100 amino acids. 10. The transgenic mouse of claim 9, wherein the C-terminal LXXLL motif polypeptide is about 80 amino acids. 11. The transgenic mouse of claim 10, wherein the C-terminal LXXLL motif polypeptide is about 60 amino acids. 12. The transgenic mouse of claim 11, wherein the C-terminal LXXLL motif polypeptide is about 50 amino acids. 13. The transgenic mouse of claim 12, wherein the C-terminal LXXLL motif polypeptide is about 30 amino acids. 14. The transgenic mouse of claim 13, wherein the C-terminal LXXLL motif polypeptide is about 10 amino acids. 15. The transgenic mouse of claim 2, wherein the second C-terminal LXXLL motif polypeptide is represented by SEQ ID NO : 3, SEQ ID NO : 14, SEQ ID NO : 15, SEQ ID NO : 16, SEQ ID NO : 17, or SEQ ID NO : 18. 16. The transgenic mouse of claim 1, wherein the DNA sequence is under the control of a constitutive promoter. 17. The transgenic mouse of claim 1, wherein the DNA sequence is under the control of an inducible promoter. 18. The transgenic mouse of claim 1, wherein the DNA sequence unit is present heterozygously or homozygously. 19. An isolated tissue isolated from the transgenic mouse of claim 1. 20. An isolated cell line isolated from the transgenic mouse of claim 1. 21. A method for identifying an agent which is an antagonist or agonist of LXR trans activating activity, said method comprising administering a test agent to a transgenic mouse of claim 1, and determining if said test agent promotes or inhibits LXR trans activating activity in said transgenic mouse as compared with a corresponding transgenic mouse to which said test agent has not been administered. 22. A method for identifying an agent which inhibits atherosclerosis formation, said method comprising administering a test agent to a transgenic mouse of claim 1, and determining if said test agent inhibits atherosclerosis formation in said transgenic mouse as compared with a corresponding transgenic mouse to which said test agent has not been administered. 23. A method for identifying an agent which is an antagonist or agonist of LXR trans activating activity, said method comprising administering a test agent to a transgenic mouse cell line of claim 20, and determining if said test agent promotes or inhibits LXR trans activating activity in said transgenic mouse cell line as compared with a corresponding transgenic mouse cell line to which said test agent has not been administered. FIELD OF THE INVENTION The present invention relates to the fields of Activating Signal Cointegrator-2 (ASC-2) and Liver X Receptor (LXR) biology and transgenic non- human mammals that incorporate the carboxy portion of ASC-2 into the genome. Specifically, the present invention relates to mice which express C-terminal LXXLL (SEQ ID NO : 1) motif. The present invention also relates to identifying agonists and antagonists of LXR activity, including LXR trans activation of target gene expression. The invention also relates to identifying agents that inhibit formation of atherosclerosis. GENERAL BACKGROUND AND STATE OF THE ART The nuclear receptor superfamily is a group of proteins that regulate, in a ligand-dependent manner, transcriptional initiation of target genes by binding to specific DNA sequences named hormone response elements (Mangelsdorf et al. 1995. Cell 83 : 835-839). Genetic studies indicate that transcription coactivators without specific DNA-binding activity are essential for transcriptional activation, which led to the identification of many proteins interacting with the C-terminal ligand- dependent trans activation domain of nuclear receptors (Lee et al. 2001. Cell. Mol. Life Sci. 58 : 289-297; McKenna et al. 2000. J. Steroid Biochem. Mol. Biol. 74: 351- 356; Rosenfeld et al. 2001. J. Biol. Chem. 276: 36865-36868). These coactivators, including the p160 family, CBP/p300, p/CAF, TRAP/DRIP and many others, bridge transcription factors and the basal transcription apparatus and/or remodel the chromatin structures. ASC-2, also named AIB3, TRBP, RAP250, NRC and PRIP, is a recently isolated transcriptional coactivator molecule, which is gene-amplified and overexpressed in human cancers and stimulates trans activation by nuclear receptors, AP-1, NF B, SRF, and numerous other transcription factors (Caira et al. 2000. J. Biol. Chem. 275 : 5308-5317; Mahajan et al. 2000. MoL Cell. Bill. 28 : 5048- 5063; Ko et al. 2000. Proc. Natl. Acad. Sci. USA 97 : 6212-6217; Lee et al. 1999. J. Biol. Chem. 274: 34283-34293; Lee et al. 2000. Mol. Endocrinol. 14 : 915-925; Lee et al. 2001. Mol. Endocrinol. 15: 241-254; Tanner et al. 1996. Cancer Res. 56: 3441- 3445; Zhu et al. 2000. J. Biol. Chem. 275 : 13510-13516). In particular, the single cell microinjection results with ASC-2 antibody demonstrated that endogenous ASC- 2 is required for trans activation by nuclear receptors and AP-1 (Lee et al. 1999. J. Biol. Chem. 274: 34283-34293; Lee et al. 2000. Mol. Endocrinol. 14: 915-925). More recently, ASC-2 was found to exist in a steady-state complex of 2 MDa, which also contains histone H3-lysine 4-specific methyltransferase enzymes (Goo et al. 2003. Mol. Cell. Biol., in press). Interestingly, ASC-2 contains two nuclear receptor- interaction domains (Lee et al. 2001. Mol. Endocrinol. 15: 241-254), both of which are dependent on the integrity of their core LXXLL sequences (Heery et al. 1997. Nature 387: 733-736; Torchia et al. 1997. Nature 387: 677-684). The C-terminal LXXLL motif specifically interacts with the liver X receptor (LXR) and LXR, whereas the N-terminal motif binds a broad range of nuclear receptors (Lee et al. 2001. Mol. Endocrinol. 15 : 241-254). L (NR1H3) and LXR (NR1H2) are known to control cholesterol and fatty acid metabolism. LXR is expressed mainly in the liver whereas LXR is ubiquitously expressed (Teboul et al. 1995. Natl. Acad. Sci. USA 92 : 2096-2100; Wiily et al. 1995. LXR, Genes Dev. 9 : 1033-1045). The physiological ligands for LXR are oxysterols and the most potent ones are 22 (R)-hydroxycholesterol, 24 (S)- hydroxycholesterol, and 24 (S), 25-epoxycholesterol (Lehmann et al. 1997. J. Biol. Chem. 272: 3137-3140). Activation of LXR in macrophages results in increased expression of genes encoding ATP-binding cassette (ABC) cholesterol transporters ABCA1 (Costet et al. 2000. J. Biol. Chem. 275: 28240-28245 ; Repa et al. 2000. Science 289: 1524-1529; Schwarz et al. 2000. Biophys. Res. Commun. 274: 794- 802; Venkateswaran et al. 2000. Proc. Natl. Acad. Sci. U S A 97: 12097-12102) and ABCG1 (Laffitte et al. 2001. Proc. Natl. Acad. Sci. USA 98: 507-512; Venkateswaran et al. 2000. J. Biol. Chem. 275 : 14700-14707) and apolipoprotein E (Laffitte et al. 2001. Proc. Natl. Acad. Sci. U S A 98 : 507-512) that are involved with cholesterol effluxfrom macrophages toward high density lipoproteins. In the liver, LXR is involved in transcriptional control of Cyp7A , encoding a critical enzyme in the conversion of cholesterol into bile acids (Lehmann et al. 1997. J. Biol. Chem. 272: 3137-3140 ; Peet et al. 1998. Ce//93 : 693-704), as well as ABCG5ABCG8 (Berge et al. 2000. Science 290 : 1771-1775; Repa et al. 2002. J. Biol. Chem. 277 : 18793-18800), encoding ABC transporters implicated in biliary cholesterol excretion. induction of intestinal ABCA9, ABCG5, and ABCG8 expression upon LXR activation accelerates fecal cholesterol disposal by reducing the efficiency of cholesterol absorption (Repa et al. 2000. Science 289 : 1524-1529). LXR has also been reported to control genes that encode proteins involved in de novo lipogenesis. In particular, induced transcription has been reported for the gene encoding SREBP- 1c (Repa et al. 2000. Genes Dev. 14: 2819-2830; Schultz et al. 2000. Genes Dev. 14: 2831-2838; Yoshikawa et al. 2001. Mol. Cell. Biol. 21: 2991-3000), the transcription factor that regulates expression of various lipogenic genes, including those encoding acetyl-CoA carboxylase and fatty acid synthase (Horton et al. 1998. J. Clin. Invest. 101: 2331-2339). In addition, LXR is known to directly influence transcription of genes encoding fatty acid synthase (Joseph et al. 2002. J. Biol. Chem. 277: 11019-11025), lipoprotein lipase (Zhang et al. 2001. J. BioL Chem. 276: 43018-43024), cholesterol ester transfer protein (Luo et al. 2000. J. Clin. Invest. 105 : 513-520), and stearoyl-CoA desaturase-1 (Liang et al. 2002. J. Biol. Chem. 277: 9520-9528). Gene targeting approaches to elucidate the role of many coactivators in mice have often been hampered by early embryonic lethality or functional redundancy. In particular, deletion of the ASC-2 gene also resulted in early embryonic lethality (Jianming Xu, personal communications). As an alternative approach, we have recently expressed a dominant negative fragment of ASC-2 encompassing the N-terminal LXXLL (SEQ ID NO : 1) motif (i. e., DN1) in mice, which inhibited the recruitment of the endogenous ASC-2 to nuclear receptors. These DN1-TG mice exhibited a plethora of developmental and phenotypic abnormalities in mice, including problems with eye, heart, motor activities, and fat metabolism in the liver (Kim et al. 2003. Mol. Cell. Biol., in press). Importantly, these mice were significantly compromised for their ability to respond to exogenous ligands, including retinoids and others (Kim et al. 2003. Mol. Cell. Biol., in press; and our unpublished results). lOOOSl The mouse is the model of preference in the study of the mammalian genetic system, and a great deal of research has been performed to map the murine genome. In this report, we took a similar approach and established transgenic mice expressing DN2, a dominant negative fragment of ASC-2 that encompasses the LXR-specific second LXXLL (SEQ) D N0 : 1) motif and potently represses trans activation by LXRs in cotransfections. Accordingly, these DN2-TG mice exhibited phenotypes that are highly homologous to those previously observed with LXR (-/- ) mice (Peet et al. 1998. Cell 93 : 693-704). Together with the DN1-TG mice results (Kim et al. 2003. Mol. Cell. Biol., in press), these results strongly indicate that ASC-2 is a physiologically pivotal transcriptional coactivator protein of LXRs and other nuclear receptors in vivo. There is a continuing need in the art to make factors that enhance fat metabolism, and in particular screen for and obtain compounds that affect the interaction between ASC-2 and LXR proteins, and that are useful in particular for treating or preventing atherosclerosis SUMMARY OF THE INVENTION [0010] The invention provides a mouse model to study the relationship between ASC-2 and LXR and fat metabolism. Also, the invention provides for a method of determining agents that may stimulate or inhibit the activity of LXR, in particular LXR trans activation activity in the presence of an expressed polypeptide comprising the C-terminal part of ASC-2, which includes the C-i : erminal L) V (LL (SEQ lD 1) motif. Accordingly, the present invention provides at least the following : [0011] In one aspect, the present application is directed to a transgenic mouse whose genome comprises a DNA sequence unit encoding a fragment of Activating Signal Cointegrator-2 (ASC-2) comprising a C-terminal LXXLL motif polypeptide but not N-terminal LXXLL motif polypeptide, wherein Liver X Receptor (LXR) trans activating activity is inhibited. The length of the C-terminal LXXLL motif polypeptide may be about 100,80, 60,50, 30, or 10 amino acids. In another aspect of the invention, the C-terminal LXXLL motif polypeptide may be the second C-terminal LXXLL motif polypeptide, and may include about 100,80, 60,50, 30, or 10 amino acids. Further, the second C-terminal LXXLL motif polypeptide may be represented without limitation by Leu Val Ser Pro [0013] In the transgenic mouse, the DNA sequence may be under the control of a constitutive promoter or an inducible promoter. Moreover, the DNA sequence unit may be present heterozygously or homozygously. The invention is also directed to an isolated tissue, cell line or cell isolated from the transgenic mouse described above. The invention is also directed to a method for identifying an agent which is an antagonist or agonist of LXR trans activating activity, said method comprising administering a test agent to the transgenic mouse described above, and determining if said test agent promotes or inhibits LXR trans activating activity in said transgenic mouse as compared with a corresponding transgenic mouse to which said test agent has not been administered. In another aspect, the invention is directed to a method for identifying an agent which inhibits atherosclerosis formation, said method comprising administering a test agent to a transgenic mouse described above, and determining if said test agent inhibits atherosclerosis formation in said transgenic mouse as compared with a corresponding transgenic mouse to which said test agent has not been administered. In one aspect of the above-described screening assay, a test compound may be incubated with the transgenic mouse, or tissues or cell lines derived therefrom, and the expression of the reporter sequence fused to target genes may be assayed. In this fashion, test compounds can be identified, which are capable of either stimulating or inhibiting the expression of a DNA sequence which is controlled by LXR. These and other objects of the invention will be more fully understood from the following description of the invention, the referenced drawings attached hereto. BRIEF DESCRIPTION OF THE DRAWINGS The present invention will become more fully understood from the detailed description given herein below, and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention, and wherein; FIGURE 1 shows DN2, as a specific dominant negative repressor of LXR trans activation. (A) A series of chimeric proteins containing amino acids of the second LXXLL (SEQ ID NO : 1) motif region within the context of ASC2-2c were constructed using two step PCR procedures and synthesized as labeled proteins expressed by in vitro translation by using the TNT-coupled transcription-translation system, with conditions as described by the manufacturer (Promega, Madison, WI). These proteins were incubated with GST fusion to TR and LXR in the absence and presence of either 0.1 M of T3 or 10 M of 22 (R)-hydroxycholesterol, as previously reported (Lee et al. 2001. Mol. Endocrinol. 15: 241-254). 20% of the total reaction mixture was loaded as input. The ASC-2 residues 875-907 and 1,479- 1,511 containing the first and second LXXLL (SEQ ID NO : 1) motif, respectively, are denoted as gray and open boxes. (B) Oxysterol-responsive LXRE-LUC reporter construct was cotransfected into HeLa cells, along with LacZ expression vector (100 ng) and expression vectors for ASC-2, DN2 or DN2/m, as indicated. Closed and shaded boxes indicate the absence and presence of 10 M of 22 (R)- hydroxycholesterol, respectively. Normalized luciferase expressions from triplicate samples were calculated relative to the LacZ expressions. Similar results were obtained with CV-1 cells (data not shown). FIGURE 2 shows specific action of DN2 against ASC-2. (A) Oxysterol- responsive LXRE-LUC reporter construct was cotransfected into CV-1 cells, along with LacZ expression vector (100 ng) and expression vectors for DN2, ASC-2, TRAP220 or SRC-1, as indicated. Closed and shaded boxes indicate the absence and presence of 5 M of T0901317, respectively. Normalized luciferase expressions from triplicate samples were calculated relative to the LacZ expressions. (B) ASC-2 recruitment to the LXRE region of SREBP-1 c. 293 cells were cotransfected with expression vectors for DN2 (50,100 ng) and DN2/m (50,100 ng) in the presence of 5 M of T0901317, as indicated. Chromatin from these cells was isolated and immunoprecipitated by indicated antibodies. The endogenous SREBP-1 c-LXRE region present in the immunoprecipitated samples was amplified by PCR and input PCR (10%) was shown for loading controls. Similar results were also obtained in the absence of ligand (data not shown). FIGURE 3 shows morphology and histology of livers from DN2-TG versus wild type mice on high cholesterol diets. (A) Expression of DN2 was assessed with indirect immunofluorescence with HA antibody. (B) Gross morphology of livers from male DN2-TG and wild-type mice fed chow supplemented with 2% cholesterol for 90 days. The development of fatty livers in the DN2-TG mice is evident after 7 days on the high-cholesterol diet. (C) Liver sections from (B) were prepared for histology and stained with H & E or oil red 0. The unstained vacuoles visible in the H & E-stained sections of the DN2-TG mice on the high- cholesterol diet stain positive (red color) for lipids with oil red 0. (D, E) Measurements of plasma and hepatic cholesterol quantitated enzymatically from extracts of the livers in (B). All values are expressed as mean SEM, n = 5. FIGURE 4 shows impaired lipogenesis in DN2-TG mice. (A) Liver sections from wild type and DN2-TG mice treated orally with vehicle or 50 mg/kg of T0901317 for 6 days were prepared for histology and stained with oil red 0. (B) Measurements of hepatic triglyceride quantitated enzymatically from extracts of the livers in (A). All values are expressed as mean SEM, n = 5. FIGURE 5 shows RT-PCR analyses of LXR target genes in DN2-TG mice. Total RNA was prepared using Trizol reagent (Life Technologies) according to the instructions given by the manufacturer from wild type and DN2-TG mice non- treated or treated with either high cholesterol diet for 60 days (A) or 50 mg/kg of T0901317 for 6 days (B). Semi-quantitative RT-PCR was used to determine the relative levels of mRNA for lipoprotein lipase, ABCA1, ABCG1, ABCG5, ABCG8, fatty acid synthase, Cyp7A1, LXR, SCD-1, acetyl-CoA carboxylase, DN2, GAPDH and Actin. TABLE 1 shows a summary of phenotypes observed with DN1-TG and DN2-TG mice. (ND) not determined. (NA) not applicable due to the absence of eye. PHPV, persistent hyperproliferation of primary vitreous. DN1/m-TG and DN2/m-TG mice had no detectable phenotypic defects (data not shown). TABLE 2 shows a list of genes most responsive to T0901317. Among 38 inducible and 38 repressible genes by T0901317, targets of DN2 are indicated by "*". ID indicates identification number for each gene in nucleotide database. -and + indicate the absence and presence of ligand treatment (50 mg/kg of T0901317 for 6 days). TABLE 3 shows a list of genes most responsive to DN2. Among 22 up- regulated and 25 down-regulated genes in T0901317-treated DN2-TG over T0901317-treated wild type mice, 12 and 15 genes indicated by "*" were genes regulated by T0901317 in wild type mice, respectively. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS In the present application,"a"and"an"are used to refer to both single and a plurality of objects. As used in the present application, amino acid symbols where an amino acid sequence is intended include the following: Phenylalaninie Phe (F) Leucine Leu (L) Serine Ser (S) Tyrosine Tyr (Y) Cysteine Cys (C) Tryptophan Trp (W) Leucine Leu (L) Proline Pro (P) Histidine His (H) Glutamin Gln (Q) Arginine Arg (R) Isoleucine Ile (I) Methionin Met (M) Threonine Thr (T) Valine Val (V) Asparagine Asn (N) Lysine Lys (K) Serine Ser (S) Arginine Arg (R) Alanine Ala (A) Aspartic Acid Asp (D) Glutamic Acid Glu (E) Glycine Gly (G) Unknown or Other Xaa (X) [0030] As used herein,"administering"a test compound to an animal refers to providing to the animal the test compound so that the effect of the test compound is assayable. The formulation of compounds for administering to an animal is generally known in the art. Dosage regime may be adjusted to provide the optimum response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the desired outcome for any particular indicia to be screened. The test compound may be administered in a convenient manner such as by the oral, intravenous (where water soluble), intramuscular, subcutaneous, intra nasal, intradermal or suppository routes or implanting (eg using slow release molecules by the intraperitoneal route or by using cells e. g. monocytes or dendrite cells sensitised in vitro and adoptively transferred to the recipient). Depending on the route of administration, the peptide may be required to be coated in a material to protect it from the action of enzymes, acids and other natural conditions which may inactivate said ingredients. The test compounds may also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. As used herein, the"agent"or test compound screened in the inventive assay may be, but is not limited to, peptides, carbohydrates, synthetic compounds, chemicals and so on. The agent may be selected and screened at random, rationally selected or rationally designed using protein modeling techniques which are well-know in the art. For random screening methods, peptides or carbohydrates are selected at random and are assayed for their ability to bind to LXR present in mice or cell lines described in the present invention. Assay methods may include either direct or indirect detection methods. Alternatively, the agents that are tested may be rationally selected. As used herein, an agent is said to be "rationally selected"when the agent is chosen based on an analysis of the physical structure of the target and the agent and determining the probability of interaction. As used herein,"normal expression"is defined as the level of expression which is present in a wild-type or non-altered animal. A variety of techniques known in the art can be used to quantitate the level at which a given protein is expressed. These include, but are not limited to immunological techniques such as an ELISA, RIA, or western blot, or quantitative analytical techniques such as spectroscopy or flame chromatography. As used herein, "ASC-2" refers to the protein as indicated in SEQ ID NO : 13. However, it is understood that by ASC-2, it encompasses all polypeptides that have the activity ascribed to ASC-2 and as a result, include certain amino acid sequence variants. The amino acid alterations may include substitutions, insertions, deletions or any desired combinations of such changes in the native ASC-2 amino acid sequence. As used herein, "transgenic non-human mammal" includes the founder transgenic non-human mammals as well as progeny of the founders. The nucleic acid construct includes a regulator element operably linked to a nucleic acid sequence encoding a C-terminal LXXLL motif polypeptide. Nucleic acid constructs can be produced through standard recombinant DNA techniques. Transgenic non- human mammals can be farm animals such as pigs, goats, sheep, cows, horses, and rabbits, rodents such as rats, guinea pigs, and mice, and non-human primates such as baboons, monkeys, and chimpanzees. Transgenic mice are particularly useful. As used herein, "C-terminal LXXLL motif polypeptide" refers to a C- terminal LXXLL motif polypeptide of any length. Expression of the C-terminal LXXLL motif polypeptide is linked to LXR trans activation activity in the transgenic non- human mammals. The C-terminal LXXLL motif polypeptide can be wild-type or can contain at least one mutation which does not harm its LXR binding function. Regulator elements provide expression of the C-terminal LXXLL motif polypeptide in sufficient levels to produce a condition whereby LXR trans activation activity is substantially inhibited. Regulatory elements include, for example, promoters, enhancers, inducible elements, and other upstream promoter elements. A variety of regulator elements can be used to control expression of the C-terminal LXXLL motif polypeptide. A non-limiting example of the promoter that may be used includes human p-actin gene promoter. Others that may be used include the metallothionein promoter and so on. Preferably, the second C-terminal LXXLL motif may be used. The core of the second LXXLL motif sequence can be found embedded in SEQ ID NO : 3 and is shown as LSQLL (SEQ ID NO : 19). By the second C-terminal LXXLL motif polypeptide, it is meant any polypeptide that encompasses this LXXLL motif, and further may include any sequence, native or chimeric, so long as the binding specificity to LXR is preserved. The length of the second C-terminal LXXLL motif polypeptide is not limited by any number of amino acids, but may include about 100, 80, 60, 50, 30, or 10 amino acids. Dz as a specific dominant negative mutant of LXR. l003Ul We have previously characterized the second C-terminal LXXLL (SEQ) D NO : 1) motif of ASC-2 as a specific interaction interface with LXRs (Lee et al. 2001. Mol. Endocrinol. 15 : 241-254). In an effort to identify important residues for this specificity, we constructed a series of chimeric proteins that incorporate various residues of the second LXXLL (SEQ ID NO : 1) motif into ASC2-2c. Radio-labeled ASC2-2c itself, which consists of the ASC-2 residues 849-1, 057 containing the first LXXLL (SEQ ID NO : 1) motif, bound to GST protein fused to TR but not LXR (Fig. 1A). The interactions were T3-dependent as previously reported (Lee et al. 2001. Mol. Endocrinol. 15: 241-254). However, introduction of as little as 10 residues surrounding the second LXXLL (SEQ ID NO : 1) motif was sufficient to change the binding specificity of the resulting chimeric protein (i. e. , ASC2-2c/m7) to bind GST-LXR (Fig. 1A). Consistent with these results, specific residues within this 10 amino acid region in ASC2-2c/m7 were identified as residues most critical for the LXR binding, as demonstrated from our recent random mutagenic analyses of an approximately 100 amino acid region surrounding the second LXXLL (SEQ ID NO : 1) motif of ASC-2 (our unpublished results). Interestingly, the sequences of this second LXXLL (SEQ ID NO : 1) motif were unique and we could not find any similar motif in different protein databases. DN2, formally called ASC2-4LR (Lee et al. 2001. Mol. Endocrinol. 15: 241-254), encodes the ASC-2 residues 1,431-1, 511 containing the second LXXLL (SEQ ID N0 : 1) motif. We have previously reported that DN2 represses trans activation by LXR (Lee et al. 2001. Mol. Endocrinol. 15: 241-254). Similarly, DN2 was a potent dominant negative mutant of LXR in cotransfections both in the absence and presence of its ligand 22 (R)-hydroxycholesterol (Fig. 1 B). In contrast, DN2/m, in which the LXXLL (SEQ ID NO : 1) motif was mutated to LXXAA (SEQ ID NO : 8), had no effect. It should be noted that DN2 had no effect on trans activation by other nuclear receptors that do not bind the second motif of ASC-2, including thyroid hormone receptors and retinoic acid receptor. (data not shown). Importantly, the inhibition was rescued by coexpressed ASC-2 but not by two well- characterized LXXLL (SEQ ID NO : 1) -type coactivators SRC-1 and TRAP220 (Fig. 2A). These results were further confirmed in chromatin immunoprecipitation assays with 293T cells cotransfected with vectors encoding DN2 and DN2/m. As shown in Fig. 2B, the LXRE region of SREBP-1c was occupied by ASC-2, TRAP220 and GRIP1. DN2 specifically inhibited the recruitment of ASC-2 without interfering with the recruitment of TRAP220 and GRIP1. In contrast, DN2/m had no significant effect on the recruitment of any of these factors. Similar results were also obtained in the absence of exogenous ligand, consistent with the reported, relatively higher basal activities of LXRs under these conditions (Teboul et al. 1995. Proc. Natl. Acad. Sci. USA 92: 2096-2100; Willy et al. 1995. Genes Dev. 9: 1033-1045) (data not shown). The exact mechanism responsible for this specificity is not currently clear. Nonetheless, these results demonstrate that DN2 can serve as an excellent tool to study the LXR-specific function of ASC-2; i. e. , DN2 specifically inhibits LXR trans activation by blocking the recruitment of the endogenous ASC-2 to LXRs bound to the target promoters. Construction of DN2-TG mice and their phenotypic analyses. Based on the results presented above, we hypothesized that any phenotype in DN2-expressing transgenic mice not observed with DN2/m-expressing mice should reflect the in vivo function of ASC-2 specific to LXRs. Thus, we exploited the ubiquitously active-actin promoter to obtain three independent transgenic founder mouse lines that express HA-tagged DN2 in various tissues examined (designated as DN2-TG) as well as two HA-DN2/m-expressing founder lines (designated as DN2/m-TG). Interestingly, the DN2-TG mice did not show any apparent phenotype, in contrast to a variety of pathologic anomalies recently reported with DN1-TG mice (Table 1). However, it should be noted that this lack of phenotype was consistent with the specificity of DN2 to LXRs and the presence of no apparent developmental function ascribed to LXRs (Teboul et al. 1995. Proc. Natl. Acad. Sci. USA 92 : 2096-2100 ; Willy et al. 1995. Genes Dev. 9: 1033-1045). impaired cholesterol metabolism with DN2-TG mice upon high cholesterol diet. As the expected lack of apparent phenotypes was confirmed, we next explored the status of the known signaling pathways of LXRs in DN2-TG mice. Among the three major physiological targets of LXRs with regard to cholesterol and fatty acid metabolism (i. e. , the liver, macrophage and intestine), we decided to focus on the detailed phenotypic analyses of the liver. The results with their macrophages and intestines will be described elsewhere. First, the expressions of DN2 and DN2/m in the livers of DN2-TG and DN2/m-TG mice, respectively, were confirmed by indirect immunofluorescence assays (Fig. 3A). It should be noted that mice Jacking LXR were previously shown to lose their ability to respond normally to dietary cholesterol and are unable to tolerate any amount of cholesterol in excess of that which they synthesize de novo (Peet et al. 1998. Cell 93 : 693-704). Thus, we tested the effect of a diet rich in cholesterol (chow supplemented with 2% cholesterol). Remarkably, there were dramatic morphological, histological, and chemical changes in the livers of DN2-TG mice fed the same diet. Within 7 days of beginning the 2% cholesterol diet and chronically worsening over a 90-day period, there was a prominent color and size change in the DN2-TG livers (Fig. 3B). Consistent with the known ability of wild-type animals to adapt quickly to cholesterol- rich diets, the livers of wild type animals maintained relatively normal appearance and function. As expected, at least two independent DN2/m-TG lines were phenotypically indistinguishable from wild type mice, allowing us to use both DN2/m- TG and wild-type mice as controls. Histological examination of the DN2-TG mice livers revealed the presence of a time-dependent increase in the number and size of intracellular vacuoles, characteristic of lipid deposits (Fig. 3C). Oil red 0 staining of these liver sections verified the deposition of lipid. Plasma cholesterol levels rose significantly (>200%) over the course of the 90-day, high-cholesterol diet in DN2-TG mice, while wild-type mice characteristically showed no change (Fig. 3D). Chemical analysis showed that the accumulated lipid with the livers of DN2-TG mice is in the form of cholesterol (Fig. 3E). In wild type animals, there were relatively less significant changes in liver histology, size, and hepatic cholesterol levels (Figs. 3B, C and E). Overall, these results strongly support the importance of ASC-2 as a specific coactivator of LXRs in vivo. Impaired de novo lipid synthesis in the liver of DM2-TG mice. LXR has been reported to control genes that encode proteins involved in de novolipogenesis. These include SREBP-1c (Horton et al. 1998. J. Clin. Invest. 101: 2331-2339; Repa et al. 2000. Genes Dev. 14: 2819-2830; Schutz et al. 2000. Genes Dev. 14: 2831-2838; Yoshikawa et al. 2001. Mol. Cell. Biol. 21: 2991-3000), fatty acid synthase (Joseph et al. 2002. J. Biol. Chem. 277: 11019-11025), lipoprotein lipase (Zhang et al. 2001. J. Biol. Chem. 276: 43018-43024), cholesterol ester transfer protein (Luo et al. 2000. J. Clin. Invest. 105: 513-520), and stearyl- CoA desaturase-1 (Liang et al. 2002. J. Biol. Chem. 277: 9520-9528). Furthermore, it was recently shown that induction of these lipogenic genes with the synthetic LXR ligand T0901317 in mice is associated with increased secretion of very low density lipoprotein-triglyceride and massive hepatic steatosis along the entire liver lobule (Grefhorst et al. 2002. J. Bill. Chem. 277: 34182-34190). Consistent with these results, DN2-TG mice fed T0901317 showed reduced amount of lipid accumulation in the liver, relative to wild type mice (Fig. 4A). Similarly, examination of hepatic triglyceride levels revealed a significant, T0901317-dependent increase with wild type mice but not with DN2-TG mice (Fig. 4B). These results further strengthen the importance of ASC-2 as a specific coactivator of LXRs/n wo. A subset of LXR target genes altered in expression with DN2-TG. It is important to note that ASC-2 also has a multitude of other target nuclear receptors and transcription factors (Caira et al. 2000. J. Biol. Chem. 275: 5308-5317; Ko et al. 2000. Proc. Natl. Acad. Sci. USA 97: 6212-6217; Lee et al. 1999. J. Biol. Chem. 274: 34283-34293; Lee et al. 2000. Mol. Endocrinol. 14: 915- 925; Lee et al. 2001. Mol. Endocrinol. 15: 241-254; Mahajan et al. 2000. Mol. Cell. Biol. 20: 5048-5063; Tanner et al. 1996. Cancer Res. 56 : 3441-3445; Zhu et al. 2000. J. Biol. Chem. 275: 13510-13516). Thus, our results, which demonstrate the validity of DN2-TG mice as novel animal model to study the LXR-specific function of ASC-2 in vivo, attest to the beauty of our transgenic approach over a general deletion of the ASC-2 gene. To further confirm the LXR-specificity of DN2-TG mice as well as to identify the hepatic target genes of the LXR ligand T0901317 in mice, we analyzed the T0901317-dependent gene expression profile of DN2-TG liver by employing DNA microarray experiments. The microarrays we analyzed consisted of approximately 8,000 mouse cDNAs as well as various control genes. For these experiments, three wild type mice were treated with vehicle alone, while six wild type and three DN2-TG mice were orally fed with 50 mg/kg of T0901317 for 6 days before excising their livers to isolate total RNA. Samples from these animals were randomly paired to generate three sets of vehicle treated wild type vs. T0901317-treated wild type as well as three sets of wild type vs. DN2-TG, both treated with T0901317. The first three sets were designed to isolate all the T0901317-responsive genes, while the second three sets were designed to identify genes responsive to both DN2 and T0901317. First, the data were remarkably consistent with each other within each set. In particular, the results with genes most responsive to T0901317 and DN2 were highly reproducible both in rank order and fold induction/repression (Tables 2, 3). Second, it was interesting that only a subset of genes either up or down- regulated by T0901317 in wild type mice was affected by the presence of DN2 (Table 2). For instance, among 38 most up-regulated genes by T0901317, only 12 genes (i. e., approximately 32 %) were significantly down-regulated in DN2-TG mice relative to wild type mice (Table 2, left panel, indicated with"*"). Similarly, among 38 most down-regulated genes by T0901317, only 7 genes (i. e., approximately 18 %) were up-regulated in DN2-TG mice (Table 2, right panel). These results strongly suggest that the presence of LXR-responsive elements, either direct or indirect, is not sufficient to confer the ASC-2-responsiveness. This notion is consistent with the general requirement of highly regulated mammalian genes for multiple cis-elements and the resulting assembly of a higher order transcription enhancer complex (i. e. , enhanceosome) consisting of multiple coregulatory proteins and transcription factors occupying these cis-elements (reviewed in Maniatis et al. 1998. Cold Spring Harb. Symp. Quant. Biol. 63: 609-620). Table 3 lists most up and down-regulated genes in T0901317-treated DN2-TG mice relative to T0901317-treated wild type mice. Importantly, 55 % and 60 % of these genes were accordingly down and up-regulated by T0901317 in wild type mice, respectively (Table 3, indicated with"*"). These results further strengthen the notion that the major group of genes affected in T0901317-treated DN2-TG mice is indeed genuine LXR-target genes. It is also interesting to note that there is not a strict correlation between the rank order and the potency (i. e., fold- induction/repression). For instance, AA473153 and AA213017 are repressed by T0901317 to 0.78 and 0.48 fold, respectively, in wild type mice; i. e., AA213017 is more responsive to T0901317 (Table 3). However, Axa473153 is up-regulated by 5.00 fold in ligand-treated DN2-TG mice over ligand-treated wild type mice, whereas AA213017 is up-regulated by only 2.20 fold. Thus, a gene less responsive to ligand (i. e., AA473153) turns out to be more responsive to DN2. Overall, these results validate the utility of our DN2-TG mice as a useful model system to study the LXR- specific function of ASC-2 in vivo. Furthermore, these mice enabled us to directly identify a series of novel hepatic genes simultaneously targeted by ASC-2 and LXRs. Studies of these genes will provide an important insight into unraveling the complex hepatic signaling pathways mediated by ASC-2 and LXRs in vivo. Expression of lipid metabolizing LXR-target genes in DN2-TG mice. Unfortunately, our cDNA microarray chips did not include most of the known target genes of LXRs, particularly ones involved with reverse cholesterol transport and lipogenesis in the liver. Thus, we employed RT-PCR to directly assess the expression pattern for some of these genes in the livers of DN2-TG mice. Interestingly, these experiments revealed that only a subset of the genes examined is impaired in DN2-TG (Fig. 5A), consistent with our cDNA microarray results (Tables 2,3). For instance, the LXR-target genes ABCA1, ABCG1 and ABCG8 were less sensitive to the expression of DN2 in high cholesterol fed DN2-TG mice. However, high cholesterol diet-induced expression of LPL, ABCG5, FAS and Cyp7A1 genes were significantly impaired in DN2-TG mice. Similarly, T0901317- induced expression of LPL and ABCG5 were also impaired in DN2-TG mice (Fig. 5B). The rate-limiting step in the classical bile acid synthesis pathway utilizes the liver-specific enzyme Cyp7A1, which converts cholesterol into 7 hydroxycholesterol (Repa et al. 2000. Genes Dev. 14: 2819-2830; Schultz et al. 2000. Genes Dev. 14: 2831-2838; Yoshikawa et al. 2001. Mol. Ce//. Biol. 21: 2991- 3000). The down regulation of this gene should lead to more accumulation of cholesterol concomitant with the less conversion of hepatic cholesterol to bile acids in DN2-TG mice. The down regulation of ABCG5 (Berge et al. 2000. Science 290: 1771-1775; Repa et al. 2002. J. Biol. Chem. 277: 18793-18800), encoding an ABC transporter implicated in biliary cholesterol excretion, may also lead to the observed cholesterol accumulation in the livers of DN2-TG mice. These results, along with our cDNA microarray results, suggest that ASC-2 likely regulates only a selective set of the LXR target genes in vivo. Likewise, ASC-2 is predicted to regulate only a subset of target genes of other nuclear receptors, further supporting the importance of the context of individual target gene and cell type in ASC-2 responsiveness (Maniatis et al. 1998. Cold Spring Harb. Symp. Quant Biol. 63 : 609- 620). Our results clearly demonstrate that expression of at least a subset of LXR-target genes is impaired in DN2-TG mice. These results are correlated with the observed phenotypes of DN2-TG mice with regard to dietary cholesterol- mediated regulation of hepatic and plasma cholesterol levels (Figs. 3D and E) as well as T0901317-mediated regulation of hepatic trigylceride levels (Fig. 4B). However, we observed at least two lines of data that are inconsistent with the previous reports with regard to the regulatory function of LXRs in lipid metabolism. Hepatic triglyceride levels were significantly increased in high cholesterol diet fed DN2-TG mice, not like LXR (-/-) mice (Peet et al. 1998. Cell 93 : 693-704). In addition, plasma triglyceride levels were significantly increased with T0901317- treated DN2-TG mice, while LXR double knockout mice led to only a slight increase (Schultz et al. 2000. Genes Dev. 14: 2831-2838). A few different possibilities exist. First, DN2 may bind yet other uncharacterized nuclear receptors and the impairment of signaling pathway for these receptors may lead to the observed plasma triglyceride phenotypes. Consistent with this possibility, many genes that are not responsive to T0901317 in wild type mice were altered in expression in DN2-TG mice (AA238618, W36002, AA472154, and AA177717 in Table 2, for instance). We are currently investigating whether or not DN2 binds to other receptors, particularly ones known to be involved with lipid metabolism such as PPAR (Barak et al. 2002. Proc. Nail. Acad. Sci. USA 99: 303-308), PXR (Edwards et al. 2002. J. Lipid Res. 43: 2-12), ROR (Vu-Dac et al. 1997. J. Biol. Chem. 272: 22401-22404) and Rev-erbA (Chawla et al. 1993. J. Biol. Chem. 268: 16265-16269). One likely physiological target of these putative non-LXR type receptors that lead to the altered trigylceride levels may involve genes regulating triglyceride clearance. In this regard, it was interesting to note that very low density lipoprotein receptor (Tacken et al. 2001. Curr. Opin. Lipidol. 12: 275-279), which was not significantly regulated by T0901317 in wild type mice, was identified as a gene targeted by DN2 in DN2-TG mice. Secondly, it should be noted that DN2-TG mice are clearly different from LXR double knockout mice. In the former mice, the functional, endogenous ASC-2 still exists such that LXR signaling can function to some extent, while LXR signaling should be completely off in the latter mice. In particular, in the presence of higher doses of T0901317, at least a subset of LXR target genes was significantly up-regulated in DN2-TG mice, likely through the ability of this strong synthetic LXR ligand to overcome the repressive effect of DN2 (data not shown). DN2-TG as model for atherosclerosis [0058] DN2-TG mice have severe atheroclerosis. This is expected because LXR regulates a set of transporter genes that export cellular cholesterol outside of the cell. And when LXR function is impaired, cholesterol efflux cannot occur, leading to the development of foam cells from macrophages, which is responsible for the development of atherosclerosis. Based on these results, in one aspect of the invention, the invention is directed to an anti-atherogenic compound that modulates the function of ASC-2 with regard to LXR. Moreover, the invention is directed to screening for any agent that binds to LXR or any molecule that modulates the interaction between ASC-2 and LXR. In conclusion, we established novel transgenic mouse lines expressing a dominant negative fragment of ASC-2 that specifically blocks the recruitment of the endogenous ASC-2 to LXRs bound to the target promoters. We demonstrated that these mice were indeed impaired in their ability to respond to dietary cholesterol and the synthetic LXR ligand T0901317. These results, along with our recent results with DN1-TG mice (Kim et al. 2003. Mol. Cell. Biol., in press), led us to conclude that ASC-2 is a physiologically important transcriptional coactivator of LXRs and other nuclear receptors in vivo. From the livers of these mice, we further isolated a series of novel genes that are targeted by both ASC-2 and T0901317. Studies of these genes will provide further insights into the molecular mechanisms for the roles of ASC-2 with regard to LXRs in dietary cholesterol metabolism and lipogenesis in the livers. The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to theose skilled in the art from the foregoing description and accompanying figures. The following examples are offered by way of illustration of the present invention, and not by way of limitation. EXAMPLES Example s-Generation of transgenic mice. For construction of transgenic mice, HA-tagged DN2 and DN2/m were cloned into a mammalian expression vector pCAGGS (Niwa et al. 1991. Gene 108 : 193-199) containing the chicken-actin promoter linked to a human cytomegalovirus (CMV) immediate- early enhancer. These plasmids were microinjected into fertilized mouse eggs of C57BL6 strain. The genotype was determined by PCR and Southern analysis of genomic DNA of tail biopsies. The primer used for genotyping were 5'- CCGCTCGAGATGGCCTCCTACCCTTAT3' (SEQ ID NO : 9) and 5'- GAAGATCTTCATGTAAGCCCAGGGGG-3' (SEQ ID NO : 10). Three and two lines of independent transgenic founders expressing DN2 and DN2/m, respectively, in various different tissues were obtained, as demonstrated for transgenic expression by Western blot analysis or immunohistochemistry with HA antibody. Example 2-Chromatin immunoprecipitation. 293T cells transfected with DN2 or DN2/m-expression vector were treated with 5 pM of T0901317 for 40 min. Soluble chromatin from these cells was prepared and immunoprecipitated with indicated antibodies, as recently described (Shang et al. 2000. Cell 103 : 843- 852). The final DNA extractions were amplified using pairs of primers that encompass the LXR-responsive element of the SREBP-1c promoter region and generate a 320 bp PCR product. The primers used were 5'- AAGGGCCAGGAGTGGGTAAAC-3' (SEQ ID NO : 11) and 5'- CGCGCCGCGCCCCATTAGG-3' (SEQ ID NO : 12). Example 3-Histological examination and immunohistochemistry. Organs were excised, frozen, and sectioned in 10 m slices and stained with H&E and oil red 0 as described previously (Serrano et al. 1996. Cell 85 : 27-37). The organs examined were eyes, liver, kidney, heart, lung, spleen, stomach, brain, pituitary gland, gall bladder and adrenal gland from mouse embryos and post-natal animals. Example 4-Cholesterol and triglyceride measurement. Plasma was prepared from euthanized mice using standard centrifugation techniques and enzymatically analyzed for cholesterol and triglyceride as previously described (Ishibashi et al. 1993. J. Clin. Invest. 92: 883-893). Hepatic lipids were extracted from 0. 2g of liver and analyzed for triglyceride and cholesterol as described (Bucolo et al. 1973. Clin. Chem. 19: 476-482 ; Yokode et al. 1990. Science 250: 1273-1275). Example 5-DNA microarrays. The mouse cDNA microarrays consisted of 8, 000 cDNAs, including mouse clones from Incyte Genomics, Inc. (Palo Alto, CA) as well as housekeeping genes, tissue specific genes, positive, negative, ratio and sensitivity controls and other controls. The PCR-amplified cDNAs were printed onto CMT-GAPS II silane slide glass and processed according to the manufacturer's protocol (Corning, MA). Total RNA extracted from the treated and untreated liver of wild type and DN2-TG mice was reverse-transcribed to fluorescence-labeled cDNA probes using SuperScript II reverse transcriptase (Gibco BRL, Life Technologies, Grand Island, NY) and Cy3/Cy5-labeled dCTP (NEN Life Science Product Inc). The Cy3 and Cy5 labeled cDNAs were placed on the slide and hybridized in a hybridization chamber. The hybridized slides were scanned with the Axon Instruments GenePix 4000B (Axon, CA). Finally, the scanned images were analyzed with GenePix Pro 3.0 (Axon, CA) and GeneSpring (Silicon genetics, CA). The signals of housekeeping genes GAPDH and-actin were used for normalization. All of the references cited herein are incorporated by reference in their entirety. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention specifically described herein. Table 1 Transgenic Line Number DN1 DN2 Abnormalities 54 71 84 87 104 4 18 32 EYE Embryonic eye - +-+ NA---- -Retinal dysplasia +-+ NA---- - locally thinner or missing +-+ NA---- - membrane +-+ NA---- -PHPV -Cataracts +-+ NA---- Adult Eye - lenticonus +-+ NA---- -Cataracts + + + + +--- - + + + + + -Retinal dysplasia +-+ NA---- -Sclera locally thinner or missing +-+ NA---- - +-+ NA---- - HEART Embryonic heart -Ventricular defects ND + ND Adult heart -Atrial - - Defects-+-ND +--- RESPIRATORY TRACTS ND ND ND -Lung + -Lung + - + LIVER : fatty liver on normal diet-+-+ Fatty liver with high cholesterol diet ND + + THYMIC : agenesis-+-+ +--- SPLEEN GALL KIDENEY PITU1TARY ADRENAL MOTOR + ND MicroTable 2 Fold Fold +WT +DN2-TG +WT +DN2-TG ID +WT ID +WT AA109684 P450, 4A10 7 NA AA108438 EST 0. 37 0. 86 AA197454 EST 6. 05 0. 32* AA239479 EST 0. 43 0. 69 AI893661 P450, 4A14 6. 03 NA W66757 EST 0. 46 1. 16 AA200989 EST 5. 46 0. 38* AI604749 EST 0. 47 NA AA288170 EST 4. 20 3. 68 AA014384 EST 0. 47 * AA270506 EST 4. 18 0. 98 AA213017 Monooxygenase3 0. 48 2. 20* AI464827 EST 3. 98 P. 49 1. 46* AA444946 EST 3. 89 0. 36e 0. 50 1. 00 AA009268 3. 83 0. 95 AA245847 EST 0. 50 1. 00 W98251 EST 3. 79 0. 36* W83009 EST 0. 50 1. 08 AA239254 EST 3. 47 1. 81 AA238208 EST 0. 51 1. 00 AA175346 EST 3. 46 0. 83 AA154452 EST 0. 51 1. 10 AA458178 CD36 3. 42 0. 99 AA542013 Fibroblast growth factorreceptor 0. 52 0. 96 AA466026 EST 3. 40 0. 63 AI385792 Sulfotransferase-relatedprotein 0. 52 0. 69 AA067967 EST 3. 21 1. 06 W11846 EST 0. 53 1. 27* AA268120 P450, 3A11 2. 96 0. 94 AA239480 EST 0. 54 1. 13 W64388 Myeloid 2. 94 1. 25 AA259979 Angiotensinogen 0. 54 1. 26 AA238875 Aledehydedehydrogenase4 2. 77 1. 15 AA213062 EST 0. 54 1. 12 AA122542 EST 2. 74 1. 34 W18484 MEL91 0. 55 NA AA122814 Aledehyde 2. 66 1. 04 AA260520 Ets variant gene 6 0. 56 1. 09 AA261287 Peroxisomal 2. 59 0. 84 AA476030 EST 0. 57 0. 80 AA267605 PPARy 0. 49 AA212899 Deiodinase, iodothyronine, Type 0. 57 0. 96 AA467249 EST 2. 53 1. 28 AA277314 EST 0. 57 1. 55 W89594 EST 2. 48 0. 81 EST 0. 57 NA AA271522 EST 2. 46 1. 40 AA241936 EST 0. 57 0. 98 AA108340 C3fgene 2. 45 1. 06 AI893937 Protein 0. 58 1. 00 AA276752 EST 2. 42 0. 96 AA414106 EST 0. 58 NA AI587794 EST 2. 40 1. 01 AA153024 EST 0. 58 1. 13 AA087206 EST 2. 36 1. 22 AI605748 EST 0. 59 0. 93 AA106263 EST 2. 28 1. 24 AA266146 EST 0. 59 1. AA271043 EST 2. 28 0. 94 W47974 EST 0. 59 NA AA097860 CDC-like 2. 21 1. 02 W34018 EST 0. 60 NA AA259400 EST 2. 20 0. 71 0. 60 0. 80 AA275203 EST 2. 17 0. 96 AA122791 0. 60 1. 15 AA097194 EST 2. 15 0. 97 W10072 IGF 0. 60 0. 89 AA245078 Fatty 2. 09 0. 87 * A1390830 EST 0. 60 0. 90 AA458273 EST 2. 08 1. 12 AAI74320 EST 0. 60 1. 77 W87950 EST 2. 06 1. 01 AA276173 EST 0. 60 0. 90 Name-Table 3 Fold +WT +DN2-TG ID AA473153 EST 0. 78* 5. 00 AA288170 EST 4. 20 4. 57 AA060979 EST 0. 62 4. 17 AA020307 VLDL 0. 96 3. AA244820 EST 0. 64* 3. 06 AA238618 EST 1. 04 2. 94 AI323180 Cyclin 0. 90 2. 82 AA269533 Cyp2B9 0. 87* 2. 71 AA048915 G beta-2 related 0. 86* 2. 68 AI510113 EST 0. 84* 2. 68 AA125367 Protein tyrosine 16 0. 92 2. 65 W36002 EST 1. 01 2. 35 AA144169 EST 0. 94 2. 24 AA268608 Squalene 0. 72* 2. 23 AA276003 Prolactin 0. 73* 16 AA388607 EST 1. 13 2. 01 AA014384 EST 2. 01 AA542160 EST 1. 25 1. 98 AA213017 Monooxygenase 0. 48* 2. 20 AA268587 Serum amyloid P-component 0. 78 * 1. 80 AA290107 EST 1. 13 2. 02 AA153205 EST 0. 81 1. 77 AA472154 0. 29 W88005 EST 2. 00 0. 31 AA197454 EST 6. 05 0. 32 AA097421 Apolipoprotein 0. 32 AA255171 EST 0. 87 0. 32 W98251 EST 0. 36 AA444946 EST 3. 89 0. 36 AA108370 GST, pi 0. 37 AA008579 EST 1. 71 0. 38 AA177549 EST 1. 12 0. 38 AA200989 EST 5. 46 0. 38 AA466026 EST 0. 39 AA221226 EST 2. 69 0. 41 AA254921 Esterase31 0. 46 0. 42 AA177717 Interleukin receptor, type 1 1. 06 0. 43 AI464827 EST 3. 98 44 A1386390 Translation initiation factor 2-3 0. 44 AA064236 EST 4. 43 0. 45 AA145237 EST 0. 69 0. 45 A1893893 Cytokine-inducible protein 0. 94 051 AA245505 Cyokine-inducible protein 2 1. 16 0. 53 A1322465 Caseinolytic (E. coli) 1. 56 0. 54 AA049246 EST, NEDD4 1. 0. 56 AA175618 EST 1. 10 0. 57 AA230822 EST 1. 05 0. 57 |
|||||||
|
|
|||||||
| Visit MVSSolutions.com for info about our technology development services. Visit MVSSolutions.biz for info about our enterprise development & business services. Visit MVSSolutions.us for info about our government contractor services. |
|
||||||
|
HOME | WHO WE ARE | WHAT WE DO | AFFILIATIONS | CONTACT
US | PRIVACY STATEMENT | JOBS | NEWS |
|||||||